AP Biology
What did we do in class today?
Control of Gene Expression in Prokaryotes and Eukaryotes
Learning Target: Students will describe how controlling gene expression can lead to genetic diversity. Warm-up: Complete the conclusion questions about the first mutation on the transcription/translation lab. 1. Control of gene expression in eukaryotes 2. POGIL: Control of Gene Expression in prokaryotes HW: In your BILL, watch and take notes over the following video: http://www.bozemanscience.com/ap-bio-lab-6-molecular-biology
0 Comments
Mutations
Learning Target: Students will analyze the impacts of DNA mutations on protein products. Sit in your poster groups No warm-up Complete posters and handout. You may work in your groups on the handout, but all work should reflect individual effort. Your answers to the conclusion questions should not be the same as your group members' answers. You may need a textbook to answer some of the questions. HW: Complete the following questions on the Transcription Lab handout if incomplete in class: 1-5, 6a, 7a, 8a, 10a, 10b, 11a Genetics Resources for studying https://learn.genetics.utah.edu/ https://learn.genetics.utah.edu/content/epigenetics/ https://learn.genetics.utah.edu/content/basics/hoxgenes/ https://learn.genetics.utah.edu/content/basics/telomeres/ Warm-up: Transcribe and translate the sequence below:
AAATTTATACATGCCTCAGCGCTAGACTACTACT 1. Control of gene expression in prokaryotes 2. Transcription and translation model No homework this evening. Gene Expression
Learning Target: Students will describe, in detail, the steps of transcription and translation. No warm-up- Quiz 1. DNA replication quiz 2. Notes: Translation 3. Transcription and translation modeling lab HW: Read and take notes over the following sections of 20.1 "DNA Sequencing" "Making Multiple Copies of a Gene or Other DNA Segment" "Using Restriction Enzymes to Make a Recombinant DNA Plasmid" Gene Expression
Learning Target: Students will describe the steps in gene exression. No warm-up plicker practice quiz 1. Practice quiz 2. Transcription notes 3. Transcription model HW: Study for closed note quiz Monday Replication
Learning Target: Students will describe, in detail, the steps of DNA replication and the enzymes involved. Warm-up 4: WITHOUT using your notes write the steps, including the enzymes, to DNA replication in as much detail as possible. 1. Complete replication models. When finished constructing the model, label and describe all aspects of the poster. 2. Transcription and translation HW: Watch and take notes over the 2 videos linked below. They are about the same topic, but take notes over both. https://youtu.be/oefAI2x2CQM https://youtu.be/bKIpDtJdK8Q DNA Replication
Learning Target: Students will explain, in detail, the process of DNA replication. Warm-up 3: Explain, in detail the reason for the lagging strand. Draw the difference between the leading strand and the lagging strand. 1. Complete DNA replication notes 2. Begin DNA replication paper models HW: Show evidence for your studying Choices include: Rewrite your replication notes from class, draw and label a detailed diagram of replication that is DIFFERENT from the handout I provided, write 10 quiz questions about DNA replication, create note cards outlining the process, another method of your choice that is the equivalent effort to the options listed above Replication and DNA Structure Closed Note Quiz Monday DNA Replication
Learning Target: Students can explain, in detail, the enzymes involved in DNA replication. Warm-up 2: Identify the name and function for each of the enzymes active in DNA replication 1. Notes: DNA Replication 2. DNA replication diagram (finish all of part A, finish through number 12 on part B) HW: Complete DNA replication diagram and questions if incomplete in class (your textbook can help you if you get stuck). The videos in section 16.2 are very helpful. Hand in online lab to red bucket. Pick up handout my mailboxes.
Warm-up: QUICK WRITE. In 2 minutes write everything you can remember about DNA and RNA. 1. Building DNA molecules 2. DNA structure notes HW: Watch and take notes in BILL over Crash Course DNA and Replication. Make sure you have closed captions turned on and you pause to write things down. Hank Green speaks VERY quickly. https://www.youtube.com/watch?v=8kK2zwjRV0M&list=PL3EED4C1D684D3ADF&index=10 |
AP BiologyLook here for what we do each day. Archives
May 2020
Categories |