Warm-up 2: Fill in 2 rows of the table we made yesterday (macrophage and mast cells)
1. Notes: Cells of the Non-Specific Immune System (part 2) 2. Work session: Fill in table 3. Plant masses and class data 4. Poster gallery walk (part 1)
0 Comments
Pick up video worksheet
Warm-up 1: Explain the difference between the first and second line of defenses in the immune system. 1. Video: Bozeman Immune System 2. Notes: Non-specific immunity 3. Summary chart (ongoing assignment) Place posters in correctly labeled piles on the side of the room. Place works cited in red bucket.
No warm-up- pick up plants and measure seedling 1. Lab discussion 2. DNA history discussion (from online activity) 3. Review HW: Study for test (complete vocab also) No plants are growing. Make sure you have wet soil. They will not be watered this weekend.
Computer lab for poster. Posters due Monday.
Include citations on your poster- print the citation list and hand in separately from your paper- format: (Author, Title, publisher, city, year, website link) Pick up mutation practice by mailbox- no need to check seeds. None are growing yet.
Warm-up 8: Explain the role of the Golgi in controlling gene expression 1. Mutation practice 2. Strawberry DNA Extraction Warm-up 7: Explain the role of transcription factors in gene regulation.
1. Finish notes on graphic organizer 2. Mutation activity 3. Set up irradiated seeds lab 4. Pre-lab for strawberry DNA extraction lab Test moved to next Tuesday to accommodate lab time- posters are still due Monday.
Pick up a codon chart and a graphic organizer by the mailboxes. Warm-up 6: Using the codon chart translate the following mRNA molecule (don't forget about start and stop codons) AACAUAAUGCCAUCUGGGCCUUCGUGACCU 1. Notes: Control of gene expression 2. Practice: mutation and mRNA modification Review materials for this exam: Animations (some are not needed for this unit, but some are very useful) http://highered.mheducation.com/sites/9834092339/student_view0/chapter15/index.html Bozeman science videos (scroll down to genetics) http://www.bozemanscience.com/biology-main-page/ Pick up genetic disease research questions from mailbox Warm-up 4: Transcribe the sequence below TACAGGTCCAGCTACTAGGATCTACC 1. Notes: Mutation 2. Computer lab for project work session
No Warm-up- pick up iRespond remote, study for quiz
1. Quiz: Replication and Gene Expression 2. Computer Lab- history of DNA's discovery |