Warm-up 4: Explain the role of transcription factors in transcription.
1. Note: Translation 2. Flipbook: Transcription and Translation 3. Study for quiz: DNA/RNA, DNA replication, Transcription and Translation
0 Comments
Warm-up 3: Use the template DNA below to determine which bases would be paired with the DNA.
AATACAGGCATTTCCGGATCGATACTACG 1. Notes: Transcription 2. Diagram: DNA replication 3. Flow Chart: Transcription HW: Study for quiz Friday Warm-up 2: Explain why DNA replication must occur (remember cell division)
1. Notes: DNA Replication 2. Diagramming DNA replication 3. Complete DNA model https://highered.mheducation.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork Pick up notebooks and blue handouts from mailboxes (4th notebooks might not be done- you'll need a sheet of notebook paper for notes)
Warm-up 1: Compare DNA and RNA (think of unit 1) 1. Notes: DNA and RNA 2. Comparison of DNA and RNA 3. Build a DNA molecule. Notebook setup: 115-Unit objectives 116-Vocab 117-Stamp sheet 118-Warm-ups 119- Overflow 120-Article 121- Summary 122- Compare/Contrast DNA/RNA 123- Notes- Nucleic Acids: DNA and RNA |