Test moved to next Tuesday to accommodate lab time- posters are still due Monday.
Pick up a codon chart and a graphic organizer by the mailboxes. Warm-up 6: Using the codon chart translate the following mRNA molecule (don't forget about start and stop codons) AACAUAAUGCCAUCUGGGCCUUCGUGACCU 1. Notes: Control of gene expression 2. Practice: mutation and mRNA modification Review materials for this exam: Animations (some are not needed for this unit, but some are very useful) http://highered.mheducation.com/sites/9834092339/student_view0/chapter15/index.html Bozeman science videos (scroll down to genetics) http://www.bozemanscience.com/biology-main-page/
0 Comments
Leave a Reply. |