HHMI Click and Learn- cells of the immune system
http://www.hhmi.org/biointeractive/cells-immune-system
0 Comments
Pick up stamp sheet by mailboxes- objectives coming tomorrow
Warm-up: What is the purpose of your immune system? 1. Immune system notes 2. Immune system video 3. Immune system analogies Hand in posters to blue basket.
Pick up quiz and online DNA activity from mailbox. Warm-up: Outline the steps of transcription and translation. 1. Go over quiz 2. Unit 6 Review Must complete DNA Unit Review May choose between doing all vocab and answering unit objective questions. Test tomorrow! Warm-up: Describe one way gene expression is controlled for each of the following scenarios: pre-transcription, pre-translation, post-translation.
1. Quiz 2. Computer Lab for project Upcoming project due dates: 4/22 Brochure 4/25 Poster 4/29 PowerPoint Warm-up: Transcribe and translate the following DNA sequence:
AACTACCCAGATGCAGGGACCGCTATC Hand in Your DNA Name to the blue basket
Warm-up: Outline the steps in transcription and translation 1. Mutation notes 2. Translation summary graphic organizer 3. Mutation activity Pick up Friday's assignment from mailbox
Warm-up: Define transcription. 1. Transcription and translation notes 2. Trnnscription and Translation summary acitivity 3. Write your name in DNA Quiz over replication, transcription, and translation Thursday. Warm-up: List the enzymes involved in DNA replication. Explain their functions.
1. DNA replication diagrams 2. Complete DNA building Warm-up: What are the base pairing rules for DNA?
1. Notes: DNA replication 2. Activity: Building DNA HW: Complete DNA molecule Warm-up: What role did Maurice Wilkins, Rosalind Franklin, James Watson and Francis Crick have in identifying the structure of DNA? How did they study DNA?
1. DNA and RNA notes 2. Project work session (last work session until next week) |