honors genetics
What did we do in class today?
Warm-up 4: Instead of warm-up pick up hand out by mailboxes. This will be your warm-up. 1. Presentations: Anna, Steve, Carleigh, Patrick 2. The immune system and cancer activity (instructions below, be sure to become an expert on one type of immunotherapy) 3. Review for test if time permits Immune system and cancer activity Instructions 1.Everyone read “What is Cancer Immunotherapy”, take notes in your GILL paying particular attention to: a.What cancer immunotherapy is and how it is used b.How cancer evades the immune system c.Types of immunotherapy 2.Divide a page in your GILL into 4 quadrants, label the quadrants Cancer vaccines, CAR T-Cell Therapies, Monoclonal Antibodies, Immune Checkpoint Inhibitors 3.Read your assigned article fill in the section of your chart associated with your treatment type. Include: a.How the treatment works b.How the treatment is developed c.Examples of the treatment d.Side effects if mentioned 4.Teach your group about your assigned article Immune system and cancer links What is cancer immunotherapy? https://www.cancer.org/treatment/treatments-and-side-effects/treatment-types/immunotherapy/what-is-immunotherapy.html Monoclonal antibodies https://www.cancer.org/treatment/treatments-and-side-effects/treatment-types/immunotherapy/monoclonal-antibodies.html CAR T- Cell Therapies https://www.cancer.org/treatment/treatments-and-side-effects/treatment-types/immunotherapy/car-t-cell1.html Immune Checkpoint Inhibitors https://www.cancer.org/treatment/treatments-and-side-effects/treatment-types/immunotherapy/immune-checkpoint-inhibitors.html Cancer Vaccines https://www.cancer.org/treatment/treatments-and-side-effects/treatment-types/immunotherapy/cancer-vaccines.html
0 Comments
Warm-up 2 (for real): Explain the role of Macrophages and Helper T Cells in activation of specific immunity.
1. Presentations: Tori, Cameron, Himaja 2. Notes: T cells and B cells 3. T cell and B Cell diagrams Warm-up 2: Compare and Contrast specific immunity and non-specific immunity.
1. Notes: non-specific immunity cells and specific immunity activation 2. Clean up plant lab 3. Complete cells on non-specific immunity table (stamp) 4. Lab work time if applicable Warm-up 1: Explain the castle analogies for the immune system. 1. Finish immune system video 2. Begin notes- non-specific immunity 3. Class lab data 4. Choose presentations
No warm-up- measure and water plants, pick up purple sheet by mailbox
1. set up notebook 2. Lab data 3. Immune system intro 4. Immune system video HW: FINISH PROJECT- EMAILED PowerPoints due TOMORROW! Pick up genetic disorder questions from mailbox.
1. Measure and water plants 2. Computer lab for project Warm-up 7: list the steps of DNA replication in order (include the enzymes)
1. Check plants. Measure them and water them. 2. Go over quiz from Friday 3. Finish control of gene expression notes 4. Review for test Check plants. Measure them and water them. Take back to your desk to measure.
Warm-up 7: Translate this sequence: CGAUGCCAGGACACACCAAAUGAAAC Computer lab for genetic disease research questions. Pick up white board and marker by mailboxes
Check on plants and spray them. If you have sprouts measure them. Warm-up 6: Explain the difference between a transversion and a transition mutation. 1. Opener: White board review 2. Work session: How to transcribe and translate 3. Closing: Transcription and Translation practice, Project info Hand in DNA extraction lab
Warm- up 5: Explain why transcription and translation are called the central dogma of biology. 1. Notes: Mutations 2. Mutation lab |
hONORS GENETICSUse this page to find what we do in class each day. This should be the first place you check when you are absent. Archives
December 2019
Categories |