honors genetics
What did we do in class today?
Pick up iRespond remote at front of room
1. DNA replication and Gene Expression Quiz 2. DNA extraction lab
0 Comments
Warm-up 4: What must occur in order for transcription to begin? What must occur in order for RNA to exit the nucleus?
1. Correct assignments 2. Notes: Translation 3. Flipbook, notecards, or notebook pages for Central Dogma Warm-up 3: What would be the base pairing sequence be for the following sequence?
AATTCCGGACTGACTTACTAG 1. White boards 2. Notes: Transcription 3. Mind map- transcription 4. Build big DNA STUDY FOR QUIZ FRIDAY |
hONORS GENETICSUse this page to find what we do in class each day. This should be the first place you check when you are absent. Archives
December 2019
Categories |