Pick up graphic organizers by the mailboxes, hold on to your posters.
Warm-up 1: Explain the castle analogies for the immune system. 1. Finish immune system video 2. Begin notes- non-specific immunity 3. Gallery walk
0 Comments
No warm-up- measure and water plants
1. Lab data 2. Immune system intro 3. Immune system video HW: FINISH PROJECT- Posters due tomorrow Pick up 2 purple sheets by mailboxes, pick up notebook, pick up questions in mailboxes
1. Measure and water plants 2. Set up notebook 3. Computer lab for project Warm-up 7: list the steps of DNA replication in order (include the enzymes)
1. Check plants. Measure them and water them. 2. Go over quiz from Friday 3. Review for test TOMORROW Check plants. Water them and measure them. Take back to your desk to measure.
Warm-up 7: Finish the last question on yesterday's hand out. Computer lab for genetic disease research questions. Pick up green sheet, white board and marker by mailboxes
Check on plants and spray them Warm-up 6: Explain the difference between a transversion and a transition mutation. 1. Opener: White board review 2. Work session: How to transcribe and translate 3. Closing: Project info Hand in DNA extraction lab
Warm- up 5: Explain why transcription and translation are called the central dogma of biology. 1. Notes: Mutations 2. Mutation lab Warm-up 4: What must occur in order for transcription to begin? What must occur in order for RNA to exit the nucleus?
1. Correct assignments 2. Notes: Translation 3. Flipbook for Central Dogma STUDY FOR QUIZ TOMORROW Pick up white boards at front of room
Warm-up 3: What would be the base pairing sequence be for the following sequence? AATTCCGGACTGACTTACTAG 1. Build BIG DNA 2. White boards 3. Notes: Transcription 4. Mind map- transcription STUDY FOR QUIZ FRIDAY Warm-up 2: When does DNA replication occur? What are the 3 main phases? Generally describe what happens in each.
1. Replication Plickers 2. DNA model 3. DNA replication diagram |