Hand in DNA extraction lab
Warm- up 5: Explain why transcription and translation are called the central dogma of biology. 1. Notes: Mutations 2. Mutation lab
0 Comments
Warm-up 4: What must occur in order for transcription to begin? What must occur in order for RNA to exit the nucleus?
1. Correct assignments 2. Notes: Translation 3. Flipbook for Central Dogma STUDY FOR QUIZ TOMORROW Pick up white boards at front of room
Warm-up 3: What would be the base pairing sequence be for the following sequence? AATTCCGGACTGACTTACTAG 1. Build BIG DNA 2. White boards 3. Notes: Transcription 4. Mind map- transcription STUDY FOR QUIZ FRIDAY |