AP Biology
What did we do in class today?
Warm-up: Transcribe and translate the sequence below:
AAATTTATACATGCCTCAGCGCTAGACTACTACT 1. Control of gene expression in prokaryotes 2. Transcription and translation model HW: Open Note Quiz over the following on Thursday 3/15 Be sure to break the reading from Chapter 20 into segments over the next 3 evenings. Focus on the following segments (the 3rd is long break it over a few nights) Pages 396-400 Pages 403-407 Pages 412-423 The following diagrams are particularly useful: 20.4, 20.8, 20.9,20.11, 20.18
0 Comments
No warm-up- Quiz
1. DNA replication quiz 2. Notes: Translation 3. Transcription and translation modeling lab HW: Be sure to break the reading from Chapter 20 into segments over the next 3 evenings. Focus on the following segments (the 3rd is long break it over a few nights) Pages 396-400 Pages 403-407 Pages 412-423 The following diagrams are particularly useful: 20.4, 20.8, 20.9,20.11, 20.18 No warm-up plicker practice quiz
1. Practice quiz 2. Transcription notes 3. Transcription model HW: Study for closed note quiz Monday Warm-up 3: WITHOUT using your notes write the steps, including the enzymes, to DNA replication in as much detail as possible.
1. Complete replication diagrams 2. Transcription and translation HW: Watch and take notes over the 2 videos linked below. They are about the same topic, but take notes over both. https://youtu.be/oefAI2x2CQM https://youtu.be/bKIpDtJdK8Q Warm-up 2: Explain, in detail the reason for the lagging strand. Draw the difference between the leading strand and the lagging strand.
1. Modeling lab- DNA replication Warm-up 1: Identify the name and function for each of the enzymes active in DNA replication 1. Notes: DNA Replication 2. DNA replication diagram HW: Complete DNA replication diagram if incomplete in class (your textbook can help you if you get stuck) Test Corrections
No warm-up
1. Test time extension (15 minutes for calculations, free response, bonus) 2. Building DNA molecules 3. DNA structure notes HW: Watch and take notes in BILL over Crash Course DNA and Replication. Make sure you have closed captions turned on and you pause to write things down. Hank Green speaks VERY quickly. https://www.youtube.com/watch?v=8kK2zwjRV0M&list=PL3EED4C1D684D3ADF&index=10 |
AP BiologyLook here for what we do each day. Archives
May 2020
Categories |