AP Biology
What did we do in class today?
Warm-up: Transcribe and translate the sequence below:
AAATTTATACATGCCTCAGCGCTAGACTACTACT 1. Control of gene expression in prokaryotes 2. Transcription and translation model HW: Open Note Quiz over the following on Thursday 3/15 Be sure to break the reading from Chapter 20 into segments over the next 3 evenings. Focus on the following segments (the 3rd is long break it over a few nights) Pages 396-400 Pages 403-407 Pages 412-423 The following diagrams are particularly useful: 20.4, 20.8, 20.9,20.11, 20.18
0 Comments
Leave a Reply. |
AP BiologyLook here for what we do each day. Archives
May 2020
Categories |